You’ve hit your search limit
Start your free trial to keep exploring full traffic and performance insights.
Get Started- Home
- Analyses d’applications gratuites
- DNAConverter
Analyse de l'application DNAConverter pour le 16 mai
DNAConverter
- makoto amijima
- App Store Apple
- Payant
- Utilitaires
Want to say something, but also… not really?
This app lets you hide those feelings inside ATCG.
If saying “thank you” directly feels awkward, or being honest feels too embarrassing, just convert your message into a DNA-style ATCG sequence with this app.
■Text → Nucleotide Sequence
“Thank you” becomes something like TTTATCCATCATTCGCTCCGACAATGCTTCGGTGTT unnecessarily long and mysteriously meaningful!
Send it to someone and they won’t understand a thing, but you can feel satisfied that you “expressed your gratitude.”
■Nucleotide Sequence → Text
Even ATCG-only cryptic messages can be decoded back to the original text.
Perfect for private “secret code” chats among friends.
■Features
• Generates DNA-like sequences instantly, even though they mean nothing
• Copy & paste into messaging apps for quick sharing
• Decode mode for conversations only insiders can understand
• Absolutely no biological meaning whatsoever
Even the words you can’t say out loud might feel lighter when you hide them in ATCG.
Classement dans le store
Le classement des stores est basé sur plusieurs paramètres définis par Google et Apple.
Toutes les catégories dans
États-Unis--
Utilitaires dans
États-Unis--
Créez un compte pour voir les téléchargements mensuels moyensContactez-nous
Statistiques de classement dans le temps pour DNAConverter
Classement d'utilisation et classement Apple App Store de Similarweb pour DNAConverter
Classement
Aucune donnée disponible
Ranking par pays pour DNAConverter
Pays dans lesquels DNAConverter est le mieux classé dans ses principales catégories
Aucune donnée à afficher
Principaux concurrents & apps alternatives
Applications ayant une forte probabilité d'être utilisées par les mêmes utilisateurs, à partir du même store.
EZ Pomo
Mika Urakawa
名札交換
Ryoga Tanaka
Today - Focus on Habits
浩 吴
NewsTeller
Luxx GmbH
mai 16, 2026